
Cheek/Chick DNA Project
Y-DNA Tables
Understanding the Results. The Y-DNA test is basically a chemical yardstick that measures the length of certain segments of the Y-chromosome that have been identified as "markers." 25 separate markers are analyzed in a standard 25-marker test. Each marker receives a numerical value which is an indication of its length. To be precise, the test counts the number of "short tandem repeats" (STR's), which are bits of repeated genetic code within the marker. For example, a marker which contains the code:
GATAGATAGATAGATA
has 4 repeats of "GATA," so the result is "4." Mutations add or subtract one of the repeated segments, which increases or decreases that marker's value by one point:
GATAGATAGATA = 3
GATAGATAGATAGATA = 4
GATAGATAGATAGATAGATA = 5
etc.
Markers can vary in number as well as length. Some people may be missing certain markers, while other people have extras. Duplications are relatively common in the group of markers known as the 464 series. Most men have four copies of this marker, which scientists call 464a, 464b, 464c, and 464d. However, some men have five or more copies. In our group, three participants have duplications in the 464 series: Participant #24 has five copies, Participant #18 has six, and Participant #34 has seven.
View the Y-DNA Tables:
List of Participants